Impressão genética

Graduada em Ciências Biológicas (Unifesp, 2013)

Impressão digital genética, ou genetic fingerprint do inglês, é a característica do DNA que permite diferenciar cada indivíduo, relacionado ou não, a partir de uma amostra qualquer que contenha material genético.

Nos nossos cromossomos temos nosso material genético. Dentro dessa sequência de DNA que compõe o indivíduo, existem certos loci que não são codificadores de proteínas, nestas regiões é bem comum encontrar-se porções que possuam uma sequência de pares de bases (A, T, C, G) que se repitam, com algum padrão, um determinado número de vezes. Por exemplo, do fragmento de DNA:

“ATGCTAGCTCGATCGATCTCTAGCTAGCTAGATCGATCGATCGATCGATATATCGATCGATCGAGCTAGCTAATCTAATCTGCTATCTAGCCCTACTCACTACCCTACTCACTACCCTACTCACTACCCTACTCACTACCCTACTCACTATCTATAGGCTGCTATC” é possível notar que a sequência ‘’CCCTACTCACTA” aparece repetida 5 vezes.

Essas regiões de repetição são chamadas de microssatélites, ou STRs (em inglês, short tandem repeats). Os loci que contém esses STRs são comuns em todos seres humanos, no entanto a sequência de pares de bases e a quantidade de vezes que se repetem é variável o suficiente para ser única para cada indivíduo. É nessa porção dos microssatélites que encontramos as ‘impressões digitais’ do nosso código genético.

Assim como todo conteúdo genético, estes loci são herdados dos pais e, portanto, através deste padrão de repetição também é possível determinar se há vínculo/ parentesco entre dois indivíduos quaisquer. É através de técnicas que utilizam deste princípio que são feitos os testes de paternidade por DNA. A metodologia mais simplificada utilizada nesse contexto é a corrida das amostras de DNA em eletroforese capilar.

Além do uso para identificação de paternidade, o uso do reconhecimento da impressão digital genética também é amplamente usado na ciência forense. Atualmente o que é um procedimento padrão, a coleta de material genético das cenas de crimes vem, há mais de 20 anos, ajudando investigadores a decidir se amostras de DNA de suspeitos e as encontradas no local do crime, proveem do mesmo indivíduo. Atualmente, com os avanços tecnológicos os testes de identificação de DNA podem dar resultados com praticamente 100% de certeza, o que em casos jurídicos, pode ser essencial para determinar os casos criminais.

Referências:

<https://dnacenter.com/history-dna-testing/ > acessado em 21/11/17

<http://www.pbs.org/wgbh/nova/education/body/create-dna-fingerprint.html > acessado em 21/11/2017

Jeffreys A.J., Wilson V., Thein S.W. (1985). "Hypervariable 'minisatellite' regions in human DNA". Nature 314: 67-73. doi:10.1038/314067a0

Arquivado em: Genética